Ciencia y salud

Por José Antonio Lozano Teruel

Bacterias en nuestros ordenadores

La presencia de virus, no biológicos, sino informáticos, es algo usual en los ordenadores y luchar contra ellos consume buena parte de nuestros esfuerzos por mantenerlos operativos. ¿Qué pasaría si en lugar de virus se tratasen de bacterias? No de bacterias informáticas, sino reales, biológicas. Pues, posiblemente, aunque hoy aún nos movemos en un terreno muy especulativo, el resultado podría ser el de un gran salto cualitativo y cuantitativo en la capacidad de almacenar información por parte de nuestros sistemas informáticos.

Bacterias en nuestros ordenadores
Ilustración :: ÁLEX

SISTEMAS NUMÉRICOS

El primer disco duro informático conocido fue inventado por IBM en 1956 con el nombre de Ramac I, con un peso de una tonelada y una capacidad de almacenado de 5 M (Megabytes, millones de bytes). La  comercialización a gran escala de los discos duros  se inició  en 1960. Los discos duros que usamos para guardar informaciones en nuestros ordenadores usan un sistema de grabación magnética para almacenar  datos digitales. En la actualidad es usual la utilización doméstica de discos duros de varios Teras (1000 Gigas, un millón de Megas, un billón de bytes). Varias empresas han comenzado ya a comercializar discos duros de uso doméstico de 3TB. Aproximadamente 1 GB métrico equivale a 0,93 GiB (gigabytes binarios).

El código binario es el sistema de representación de información  que usa un sistema binario consistente en un sistema numérico de dos dígitos, o bit: el "0" (cerrado, no paso de electrones) y el "1" (abierto, paso de electrones). El byte suele referirse a un grupo de 8 bits u octetos, por lo que es posible tener 256 (28) octetos o estados binarios diferentes (00000000, 11111111, 00001111, 01010101,..etc.).

Si en lugar de un sistema binario (como un interruptor de dos posiciones), dispusiésemos de la posibilidad de un sistema cuaternario (usando los números 0, 1,2 y 3), para una determinada longitud de información, por ejemplo, el octeto anterior, las posibilidades se incrementan desde las 256 del sistema binario a las 48 = 71.936.

Muchos de nosotros recordamos que hace algunos años frecuentemente teníamos que acudir, en algunas ocasiones, al código ASCII para introducir ciertos caracteres en nuestros ordenadores. El código ASCII es una representación numérica (usando desde el 0 al 9) de símbolos ya que en los ordenadores sólo se pueden introducir números. La palabra Murcia correspondería en este código a M (77), u (117), r (72), c (63), i (105) y a (61). Esos seis números, en código binario corresponderían a 1001101, 1110101, 1001000, 111111, 1101001 y 111101, respectivamente. En código cuaternario la correspondencia del código ASCII para la palabra Murcia sería: M (1031), u (1311), r (1020), c (333), i (1221),  a (331).

ADN   

Hoy sabemos que el material genético de los seres vivos consiste, en esencia, en cadenas de ADN en las que se van sucediendo alguno de los 4 nucleótidos conocidos por la abreviatura del nombre de sus bases: A (adenina), T (timina), G (guanina), C (citosina).

Se trata, pues, de un código cuaternario. Por ejemplo, la secuencia…TACTTCTTTAGACCCTGGTCCT…, si establecemos una correspondencia con números, tales como A (0), T (1), G(2),  C(3), se nos traduciría en la secuencia numérica ….1031 1311 1020 333 1221 331…Si ahora vemos la correspondencia anteriormente comentada del código ASCI, esta secuencia significaría exactamente …Murcia

Extrapolando, ello significa que cualquier información externa, numérica, alfabética, imágenes digitalizadas, música, videos, etc., podemos transformarla en una secuencia de bases semejantes a las que existen en el ADN bacteriano, por ejemplo en el ADN de una bacteria muy común, Escherichia coli.

Entonces podríamos especular imaginando que cualquier información que deseemos almacenar la podemos codificar de este modo. Los avances de la genética y la biología molecular podrían permitir sintetizar en el laboratorio cadenas de ADN sintéticas con la secuencia predeterminada que deseemos, que en este caso sería la de la información que queramos guardar. Asimismo, podemos integrar este ADN sintético en cepas de bacterias, las cuales se pueden guardar indefinidamente, conservando la información, o se pueden dividir las veces que se deseen, conservando escrupulosamente la información almacenada. Esa información, puede ser descifrada biológicamente mediante los correspondientes sistemas de secuenciación.

POSIBILIDAD

¿Ciencia ficción?. Puede ser, pero no lo creen así los participantes, profesores y estudiantes de la Universidad China de Hong Kong, que participaron en uno de los 128 proyectos presentado al IGEM 2010 y que fue merecedor de una medalla de oro. El IGEM es el acrónimo de la International Genetically Engineered Machine Foundation,  estrechamente asociada al Instituto Tecnológico de Massachussets, dedicada a la educación y desarrollo de la Biología sintética, convocando desde el año 2003 una competición mundial de proyectos. 

De acuerdo con el proyecto presentado por este grupo de HongKong,  las mismas bacterias que hoy en día se conocen popularmente porque algunas de ellas provocan intoxicaciones alimentarias (Escherichia coli) podrían convertirse algún día en sistemas de almacenamiento informático, una especie de biodisco duro.

Sus desarrolladores aseguran que la tecnología sería completamente segura, al usar  cepas no virulentas de bacterias, las cuales sólo se reproducen y almacenan datos. Sería incluso  posible  insertar en las células de Escherichia coli un copyright que indicara la identidad del diseñador del organismo e, incluso, han diseñado una barrera de seguridad de tres niveles para codificar los datos y también una inserción de un código de barras que permita distinguir fácilmente entre microrganismos naturales y genéticamente modificados.

En términos prácticos ello significaría la posibilidad de mantener grandes volúmenes de datos a largo plazo en una caja con bacterias mantenidas en un frigorífico, a salvo de los frecuentes ataques cibernéticos, aunque …no inmunes a un fallo de suministro eléctrico. Según los cálculos que han realizado los diseñadores del sistema, en  un gramo de estas bacterias se podría almacenar el equivalente a 900 discos duros de 1 terabytes. 

Más en:

http://2010.igem.org/Team:Hong_Kong‐CUHK